Jump to content

Recommended Posts

5 hours ago, Seto Kaiba said:

... I'm beginning to see that, yes.

So much of the Star Wars plot seems to depend on coincidence and sheer dumb luck, or as the writers call it "the will of the force".  I loathe that as a literary device, because it robs the characters of any semblance of agency.  

(In that context, I can also kind of see why fans are so enamored of Grand Admiral Thrawn from the old novels.  He seems to be the only character in the entire franchise who actually had his sh*t together and whose plans made actual logical sense.)

Not to mention any accountability for their actions. Palpatine could just say his actions were "the will of the Force" if we went that route.

 

  

5 hours ago, Seto Kaiba said:

At least half the cast of Rise of Skywalker falls into that category... and one of them is heavily implied to be an actual Calrissian.

Yup.

Link to comment
Share on other sites

On 8/5/2021 at 1:34 PM, Dynaman said:

Then Palp could still be Grandpa.  Hmmmmm   Granpa Palpatine living at 1313 Mockingbird Lane - I like that idea.

OK, hang on, let's see if I can make any sense of this

Palp is Annie's daddy.

Palp is Luke and Leia's grandpa

Pal is also Rey's grandpa

So is Rey Kylo's aunt or cousin? 

And who is Rey's uncle-daddy again?  That guy who got about 5 seconds screen time in that last movie right? 

 

Link to comment
Share on other sites

13 hours ago, peter said:

OK, hang on, let's see if I can make any sense of this

Palp is Annie's daddy.

Palp is Luke and Leia's grandpa

Pal is also Rey's grandpa

So is Rey Kylo's aunt or cousin? 

And who is Rey's uncle-daddy again?  That guy who got about 5 seconds screen time in that last movie right? 

 

Escaped Palp clone.

Link to comment
Share on other sites

On 8/5/2021 at 5:46 AM, Thom said:

Oh man, that is too disturbingly funny!:rofl:

Not nearly as funny as the fact that if she then went on with Kylo, it's basically... well, the image is disturbing to say the least.

15 hours ago, peter said:

OK, hang on, let's see if I can make any sense of this

Palp is Annie's daddy.

Palp is Luke and Leia's grandpa

Pal is also Rey's grandpa

So is Rey Kylo's aunt or cousin? 

And who is Rey's uncle-daddy again?  That guy who got about 5 seconds screen time in that last movie right? 

 

Yes, so, the granddaughter, and the great grandson (meaning the auntie and the nephew) decided to get together.  This is disturbing in all kinds of ways.  Trust Lucas and Disney to come up with something twisted like that.  Just when you thought the Oedipal complex couldn't be worse, Disney takes it one step further.  Good job, mouse.

Link to comment
Share on other sites

2 hours ago, kalvasflam said:

Not nearly as funny as the fact that if she then went on with Kylo, it's basically... well, the image is disturbing to say the least.

Yes, so, the granddaughter, and the great grandson (meaning the auntie and the nephew) decided to get together.  This is disturbing in all kinds of ways.  Trust Lucas and Disney to come up with something twisted like that.  Just when you thought the Oedipal complex couldn't be worse, Disney takes it one step further.  Good job, mouse.

That's if we're going with Palpy making Anakin through the Force, but wasn't it Plagueis? And even if it was him, it was only through direct manipulation of the Force itself, rather than anything physical. So there would be no DNA in the mix. Rey's father was Palpatine's son. Kylo's mother was Shmi's grandaughter. Except for the use of the Force itself, no bloodlines were mingled.

Link to comment
Share on other sites

1 hour ago, Thom said:

That's if we're going with Palpy making Anakin through the Force, but wasn't it Plagueis? And even if it was him, it was only through direct manipulation of the Force itself, rather than anything physical. So there would be no DNA in the mix. Rey's father was Palpatine's son. Kylo's mother was Shmi's grandaughter. Except for the use of the Force itself, no bloodlines were mingled.

No DNA is arguable. It could be passing semen through the force, like passing a light saber.

Edited by Keith
Force Insemination
Link to comment
Share on other sites

1 hour ago, Thom said:

That's if we're going with Palpy making Anakin through the Force, but wasn't it Plagueis? And even if it was him, it was only through direct manipulation of the Force itself, rather than anything physical. So there would be no DNA in the mix. Rey's father was Palpatine's son. Kylo's mother was Shmi's grandaughter. Except for the use of the Force itself, no bloodlines were mingled.

So, wait... if there was no DNA in the mix besides Shmi's own, wouldn't that mean Anakin's a haploid life form and therefore sterile?  

New theory.  Anakin's a sterile, milkman-trusting, total drama queen and literally anyone else (Panaka, Palpatine, or even Jar-Jar Binks) is the father of Luke and Leia.

 

4 minutes ago, Keith said:

No DNA is arguable.

Have you ever tried to argue with DNA?  It just sits there going ATGCTTCGGCAAGACTCAAAAAATA and so on for bloody ever... :rofl:

Link to comment
Share on other sites

12 hours ago, Keith said:

No DNA is arguable. It could be passing semen through the force, like passing a light saber.

I think passing something through the Force was only possible for Dyads. Even if not though, I'll stick with him just manipulating the 'juice' of the Force.:p

12 hours ago, Seto Kaiba said:

So, wait... if there was no DNA in the mix besides Shmi's own, wouldn't that mean Anakin's a haploid life form and therefore sterile?  

New theory.  Anakin's a sterile, milkman-trusting, total drama queen and literally anyone else (Panaka, Palpatine, or even Jar-Jar Binks) is the father of Luke and Leia.

 

Have you ever tried to argue with DNA?  It just sits there going ATGCTTCGGCAAGACTCAAAAAATA and so on for bloody ever... :rofl:

More than likely just a form of asexual reproduction..?

Link to comment
Share on other sites

9 hours ago, Thom said:

I think passing something through the Force was only possible for Dyads. Even if not though, I'll stick with him just manipulating the 'juice' of the Force.:p

... everything about this entire line of inquiry is objectively awful. :rofl:

 

9 hours ago, Thom said:

More than likely just a form of asexual reproduction..?

Then shouldn't Anakin have been a girl?  Where'd the Y chromosome come from in this equation?

For now, I'm gonna stick with my theory... Anakin's extremely trusting and Luke and Leia's real father is the space milkman on Coruscant.

Link to comment
Share on other sites

2 hours ago, Seto Kaiba said:

... everything about this entire line of inquiry is objectively awful. :rofl:

 

Then shouldn't Anakin have been a girl?  Where'd the Y chromosome come from in this equation?

For now, I'm gonna stick with my theory... Anakin's extremely trusting and Luke and Leia's real father is the space milkman on Coruscant.

What'dya want!? It's all we got to work with!:rolleyes:

 

😀

Link to comment
Share on other sites

4 hours ago, Seto Kaiba said:

... everything about this entire line of inquiry is objectively awful. :rofl:

 

Then shouldn't Anakin have been a girl?  Where'd the Y chromosome come from in this equation?

For now, I'm gonna stick with my theory... Anakin's extremely trusting and Luke and Leia's real father is the space milkman on Coruscant.

Or Obi Wan.

Link to comment
Share on other sites

Y'all have gone completely off the rails lol

I know it's bad when I actually start to miss the dead-horse-beating-constant-negativity vs. the WTF incest stuff. 🤣

-b.

Link to comment
Share on other sites

34 minutes ago, Kanedas Bike said:

Y'all have gone completely off the rails lol

I know it's bad when I actually start to miss the dead-horse-beating-constant-negativity vs. the WTF incest stuff. 🤣

-b.

Sorry guys, the memes are just too funny to resist, I'll stop, hahahahaha! 

Also, the game of thrones vs Star Wars memes.... Some of those are just epic, Hahahahahaha!!! 

Link to comment
Share on other sites

8 minutes ago, peter said:

Sorry guys, the memes are just too funny to resist, I'll stop, hahahahaha! 

Also, the game of thrones vs Star Wars memes.... Some of those are just epic, Hahahahahaha!!! 

Hate to admit it that I found them all funny too! But this thread definitely took an...odd turn LOL

-b.

Link to comment
Share on other sites

48 minutes ago, Kanedas Bike said:

Y'all have gone completely off the rails lol

I know it's bad when I actually start to miss the dead-horse-beating-constant-negativity vs. the WTF incest stuff. 🤣

So, what you're saying is we need to go deeper... dig up someone's MLP/Star Wars fic so we can kill two birds with one stone by beating an incestuous dead horse?

That might be too much, even for people with a truly refined appreciation of sadism. :vava:

(FWIW, the memes are better than the actual movie IMO.)

EDIT: Something something the dark side is a pathway to many topics of discussion some would consider... unnatural.

Edited by Seto Kaiba
Link to comment
Share on other sites

5 hours ago, Seto Kaiba said:

So, what you're saying is we need to go deeper... dig up someone's MLP/Star Wars fic so we can kill two birds with one stone by beating an incestuous dead horse?

That might be too much, even for people with a truly refined appreciation of sadism. :vava:

(FWIW, the memes are better than the actual movie IMO.)

EDIT: Something something the dark side is a pathway to many topics of discussion some would consider... unnatural.

😁

Well, I enjoyed the Sequel Trilogy, I have gripes with them for sure. The greatest of which is the lack of an overall plan for the trilogy which truly led to the biggest misses from a story and character development perspective.

That said I very much enjoyed TFA and RoS and I didn't hate TLJ. For what they are that is, Star Wars has never been high cinema, they're popcorn movies. Besides the Prequels suck, suuuuuuuuuuuuuuuuuuuuuuuuucccccccccccccck. Besides Obi Wan and the spin-off animated series that is.

These memes and "that" subject though, just hilarious on so many levels.

-b.

Link to comment
Share on other sites

2 hours ago, Kanedas Bike said:

Star Wars has never been high cinema

That's a sentiment not often heard within the fandom... but aligns with professional critics, I think. 🤓

2 hours ago, Kanedas Bike said:

I very much enjoyed RoS

That's a sentiment rarely heard within the fandom... or professional critics, for that matter. :unsure:

I've never heard anyone praise The Rise of Skywalker while harshly criticizing the prequel trilogy in the same breath.  The prequels suffer from some of the most awkward acting and dialogue ever committed to film, but those are superficial problems; Rise of Skywalker, on the other hand, has much deeper conceptual flaws, actions and consequences that are not only nonsensical in their own right, but incompatible with the Star Wars mythology as a whole. <_<

While the prequels remain a disappointment to many, Rise of Skywalker has quickly become a laughingstock. :p

Link to comment
Share on other sites

40 minutes ago, tekering said:

That's a sentiment not often heard within the fandom... but aligns with professional critics, I think. 🤓

3 hours ago, Kanedas Bike said:

Well then I guess it depends on what circle of the fandom one travels in. Just like what the fandom thinks, what the professionals and YouTubers think doesn't much influence whether or not I like, or dislike a movie. I keep my own council and with that, my opinion is my own and is just as valid as anyone else's.

 

43 minutes ago, tekering said:

That's a sentiment rarely heard within the fandom... or professional critics, for that matter. :unsure:

I've never heard anyone praise The Rise of Skywalker while harshly criticizing the prequel trilogy in the same breath.  The prequels suffer from some of the most awkward acting and dialogue ever committed to film, but those are superficial problems; Rise of Skywalker, on the other hand, has much deeper conceptual flaws, actions and consequences that are not only nonsensical in their own right, but incompatible with the Star Wars mythology as a whole. <_<

While the prequels remain a disappointment to many, Rise of Skywalker has quickly become a laughingstock. :p

Again, depends on what circles one travels. And the discussion can quickly devolve into "true fans" vs. "casual or not true fans" and all of that which I'm hoping to avoid.

I am however very happy to be the first person to say that they praise The Rise of Skywalker, that you remember (:p), but people have chimed in even among the chorus of "it sucked" here on the forums. But like me they probably quickly realized it's a fools errand to try and have a conversation about what you like around these parts, SW or otherwise. It's just not worth the trouble which is kind of a bummer.

But come on, awkward acting and terrible dialogue are hardly superficial problems as it relates to cinema - I mean, that's exactly the point of movies. Acting out well constructed sentences, otherwise it might as well have been a book. :lol:

One final point re: the prequels, three movies that turned the big bad Darth Vader into an intergalactic moron. I mean, Palpatine played him like a fiddle with the dumbest plot ever. The prequels as a whole had few redeeming qualities, Obi Wan, how the Clones evolved in later media, John Williams's score, the lightsaber battles and it gets the benefit of having a cohesive, but really stupid plot across 3 terribly acted (save Ewan's performance), directed and scripted movies. But, my opinion. 

So y'all like your laughingstock, and I'll like mine. Pretty sure no opinions are going to get changed regarding these particular movies no matter what points and counterpoints we make.

I do however think that The Mandalorian is universally liked, so that's a small victory for all Star Wars fans. B))

Cheers!

-b.

Link to comment
Share on other sites

30 minutes ago, Kanedas Bike said:

Just like what the fandom thinks, what the professionals and YouTubers think doesn't much influence whether or not I like, or dislike a movie.

And indeed it should not. :good:

32 minutes ago, Kanedas Bike said:

it's a fools errand to try and have a conversation about what you like around these parts, SW or otherwise

Yes, it's difficult to contribute to a discussion when you don't hold the majority opinion, especially on this forum... :unsure:

38 minutes ago, Kanedas Bike said:

save Ewan's performance

I wouldn't. <_<

I'd say Liam Neeson and Ian McDiarmid gave the only convincing performances in the prequels.

33 minutes ago, Kanedas Bike said:

But come on, awkward acting and terrible dialogue are hardly superficial problems as it relates to cinema - I mean, that's exactly the point of movies.

I certainly wouldn't argue otherwise...! 😅

35 minutes ago, Kanedas Bike said:

I do however think that The Mandalorian is universally liked, so that's a small victory for all Star Wars fans. 

Rogue One, too. B))

Link to comment
Share on other sites

I don’t hate last Jedi, but it’s hard to defend. I found that the characters were far more likable than the prequel characters. But the movie was mostly stupid and overloaded with great ideas that never went anywhere and got in the way of other ideas. The prequels had horrible acting and the green screen thing made it look like space jam in reverse. Like there were live action people trapped in a cartoon. 

 I also am one of the only ones that seems to dislike rogue one. I liked the robot, but I hated everyone else. It did look pretty though. Solo would have been alright if it wasn’t involving existing characters, maybe it would’ve been really good.

Link to comment
Share on other sites

9 hours ago, tekering said:

Rogue One, too. B))

Yes!

 

5 hours ago, Keith said:

Revenge Of The Sith is my favorite of the franchise, deal with it!

Rock on, live your truth :lol:! Obi Wan and Vader's fight scene was very entertaining at least.

 

2 hours ago, Big s said:

overloaded with great ideas that never went anywhere and got in the way of other ideas

This about sums up all of the issues with the Sequel Trilogy. Hopefully future stories will help flesh these out in the same way The Clone Wars, Rebels, The Bad Batch, The Mandalorian etc. has done for the OT and PT.

 

2 hours ago, Big s said:

Solo would have been alright if it wasn’t involving existing characters, maybe it would’ve been really good.

X number of years later I still don't know if I actually enjoyed Solo or not. It was fun for an adventure flick and Lando was fantastic but so many of the other elements from the film, like how Solo got his name were just...ugh.

-b.

Link to comment
Share on other sites

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.

Guest
Reply to this topic...

×   Pasted as rich text.   Paste as plain text instead

  Only 75 emoji are allowed.

×   Your link has been automatically embedded.   Display as a link instead

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.

 Share

×
×
  • Create New...